Questions
I didn’t understand the fastq line with the phred scores, specifically how there are different versions, I understood the general idea but I got the question wrong and I wasn’t sure why.
How do you determine the [phred] scale of a .fastq? Give an example if possible.
FASTQ
FASTQ files have 4 lines of information for each read
@HWUSI-EAS100R:6:73:941:1973#0/1
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCC
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**
- @SEQID
- Sequence
- Starts with “+” and then usually blank
- Quality information
PHRED QUALITY
Each base has a quality score representing how confident the machine is that the base is correct.
These are called PHRED scores are range from 0 to ~ 40, where
\(PHRED = -10 * log_{10}(p)\)
and \(p\) is the probability that the reported base is wrong.
- QUESTION: If there is a 1 in 100 chance that the base is wrong, what is the PHRED score? (Try this in R)
PHRED Qualities, part 2
But how can the following encode PHRED qualities?
!''*((((***+))%%%++)(%%%%).1***-+*''))**
In computerese each character is represented internally as a number. This is called the ASCII code.
For example ! has an ASCII code of 33, * has an ASCII code of 42, etc.
Thus, these characters represent numbers, and numbers can represent quality.
Why use characters instead of numbers?
PHRED Qualities, part 3
To add an additional wrinkle, the ASCII codes must be converted to the actual PHRED scores.
Why? ASCII characters 0 - 32 are invisible so they can’t be used.
Additionally, different starting points have been used:
![Diagram showing different PHRED quality encoding schemes including Sanger (Phred+33), Solexa (Solexa+64), and Illumina 1.3+, 1.5+, and 1.8+ (Phred+64 or Phred+33). The diagram displays ASCII character ranges from 33 to 126, with corresponding PHRED quality scores ranging from 0 to 41. Different encoding schemes are shown in different colored rows with their typical quality score ranges.]()
How do we determine the PHRED scale?
Look for unique characters for the different scales and see if they are in your sequence
![Diagram showing different PHRED quality encoding schemes including Sanger (Phred+33), Solexa (Solexa+64), and Illumina 1.3+, 1.5+, and 1.8+ (Phred+64 or Phred+33). The diagram displays ASCII character ranges from 33 to 126, with corresponding PHRED quality scores ranging from 0 to 41. Different encoding schemes are shown in different colored rows with their typical quality score ranges.]()
Playposit question review
Your FASTQ file has qualities listed as “E”. Which scale was used in this file?
![Diagram showing different PHRED quality encoding schemes including Sanger (Phred+33), Solexa (Solexa+64), and Illumina 1.3+, 1.5+, and 1.8+ (Phred+64 or Phred+33). The diagram displays ASCII character ranges from 33 to 126, with corresponding PHRED quality scores ranging from 0 to 41. Different encoding schemes are shown in different colored rows with their typical quality score ranges.]()
Playposit question review
Your FASTQ file has qualities listed as “E”. Which scale was used in this file?
![Diagram showing different PHRED quality encoding schemes including Sanger (Phred+33), Solexa (Solexa+64), and Illumina 1.3+, 1.5+, and 1.8+ (Phred+64 or Phred+33). The diagram displays ASCII character ranges from 33 to 126, with corresponding PHRED quality scores ranging from 0 to 41. Different encoding schemes are shown in different colored rows with their typical quality score ranges.]()
Example
What is the PHRED scale for:
@A00953:413:HJ7WMDSX2:2:1101:27597:1031 1:N:0:AAGTGTAT+CATTAATT
AACACCTGCCCTATATACTCTCTCTCTCTCGTAGTTTCTACTTCCAGAACTCATCTCTCTCTCC
+
FFFFFFFF:FFFFFFFFF:FFFFFFFFFFFFFFFF:FFFFFFF:F:F,FFFFF,:FFFFFF,:F
![Diagram showing different PHRED quality encoding schemes including Sanger (Phred+33), Solexa (Solexa+64), and Illumina 1.3+, 1.5+, and 1.8+ (Phred+64 or Phred+33). The diagram displays ASCII character ranges from 33 to 126, with corresponding PHRED quality scores ranging from 0 to 41. Different encoding schemes are shown in different colored rows with their typical quality score ranges.]()
